Use this link to cite:
https://hdl.handle.net/2183/47470 Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii
Loading...
Identifiers
Publication date
Authors
Aranda Rodríguez, Jesús
Shingu-Vázquez, Miguel
Cortés, Pilar
Boyce, John Dallas
Adler, Ben
Barbé, Jordi
Advisors
Other responsabilities
Journal Title
Bibliographic citation
Aranda JPoza M, Shingu-Vázquez M, Cortés P, Boyce JD, Adler B, Barbé J, Bou G.2013.Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii. J Bacteriol195:.https://doi.org/10.1128/jb.00853-13
Type of academic work
Academic degree
Abstract
[Abstract] The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.
Description
Keywords
Editor version
Rights
© American Society for Microbiology






